Mouse Lrp1 activation kit by CRISPRa

CAT#: GA202490

Lrp1 CRISPRa kit - CRISPR gene activation of mouse low density lipoprotein receptor-related protein 1



CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Lrp1
Locus ID 16971
Kit Components

GA202490G1, Lrp1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCCGGTAGAGCCAAGGGT

GA202490G2, Lrp1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTACAAGCTTTGGAGTTCT

GA202490G3, Lrp1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCGGAGGCGCTACAAGCTT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_008512
Synonyms A2mr; AI316852; b2b1554Clo; CD91; Lrp
Summary Endocytic receptor involved in endocytosis and in phagocytosis of apoptotic cells. Required for early embryonic development (PubMed:1423604). Involved in cellular lipid homeostasis. Involved in the plasma clearance of chylomicron remnants and activated LRPAP1 (alpha 2-macroglobulin), as well as the local metabolism of complexes between plasminogen activators and their endogenous inhibitors. May modulate cellular events, such as APP metabolism, kinase-dependent intracellular signaling, neuronal calcium signaling as well as neurotransmission. Acts as an alpha-2-macroglobulin receptor (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...