Mouse Muc5ac activation kit by CRISPRa

CAT#: GA202762

Muc5ac CRISPRa kit - CRISPR gene activation of mouse mucin 5, subtypes A and C, tracheobronchial/gastric



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Muc5ac
Locus ID 17833
Kit Components

GA202762G1, Muc5ac gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCATTTCAGGCTAGTCAA

GA202762G2, Muc5ac gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAGTGGCCACTGTTTACCT

GA202762G3, Muc5ac gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCACCCACGTGAAGTCACT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_010844
Synonyms 2210005L13Rik; MGM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...