Mouse Pdx1 activation kit by CRISPRa
CAT#: GA203166
Pdx1 CRISPRa kit - CRISPR gene activation of mouse pancreatic and duodenal homeobox 1
CNY 12255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | Pdx1 |
Locus ID | 18609 |
Kit Components | GA203166G1, Pdx1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTACCCTGGAGCCATCAT GA203166G2, Pdx1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCTCCAGGGTAAACCACGT GA203166G3, Pdx1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCTCTGGGGCACCCCACG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_008814 |
Synonyms | IDX-1; IPF-1; Ipf1; Mody4; pdx-1; STF-1 |
Summary | Activates insulin and somatostatin gene transcription. Key regulator of islet peptide hormone expression but also responsible for the development of the pancreas, most probably by determining maturation and differentiation of common pancreatic precursor cells in the developing gut. As part of a PDX1:PBX1b:MEIS2b complex in pancreatic acinar cells is involved in the transcriptional activation of the ELA1 enhancer; the complex binds to the enhancer B element and cooperates with the transcription factor 1 complex (PTF1) bound to the enhancer A element. Binds the DNA sequence 5'-CC[CT]TAATGGG-3'.[UniProtKB/Swiss-Prot Function] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN513070 | Pdx1 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |