Mouse Sirpa activation kit by CRISPRa
CAT#: GA203483
Sirpa CRISPRa kit - CRISPR gene activation of mouse signal-regulatory protein alpha
CNY 12255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | Sirpa |
Locus ID | 19261 |
Kit Components | GA203483G1, Sirpa gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGACTCACAGCAACGGAT GA203483G2, Sirpa gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACACCGACCTGCCTGGGATT GA203483G3, Sirpa gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTATGCTGCTCATCTGTTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_001177646, NM_001177647, NM_001291019, NM_001291020, NM_001291021, NM_001291022, NM_007547, NM_001355158, NM_001355160 |
Synonyms | AI835480; Bit; CD172a; P84; Ptpns1; SHP-1; SHPS-1; SIRP |
Summary | Immunoglobulin-like cell surface receptor for CD47. Acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. Supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. May play a key role in intracellular signaling during synaptogenesis and in synaptic function. Involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. Mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation. CD47 binding prevents maturation of immature dendritic cells and inhibits cytokine production by mature dendritic cells (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN515798 | Sirpa - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |