Mouse Stat6 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Stat6
Locus ID	20852
Kit Components	GA204128G1, Stat6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAGAGAAGAGAAAGTGGGC GA204128G2, Stat6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGAGGAAGAGGAAGAAAG GA204128G3, Stat6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCCCCACCGGGTACATAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_009284
Summary	Carries out a dual function: signal transduction and activation of transcription. Involved in IL4/interleukin-4- and IL3/interleukin-3-mediated signaling.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.