Mouse Dnmt3l activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Dnmt3l
Locus ID	54427
Kit Components	GA205712G1, Dnmt3l gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACGGTTCTTAAGCTGTGA GA205712G2, Dnmt3l gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTCATGTTGACGGATCCA GA205712G3, Dnmt3l gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTGACTCCAAGTTGCCATC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001081695, NM_001284197, NM_001284198, NM_001284199, NM_001284200, NM_019448
Synonyms	D6Ertd14e; ecat7
Summary	CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.