Mouse Pnpla8 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Pnpla8
Locus ID	67452
Kit Components	GA207336G1, Pnpla8 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTGTTGGAGCTGAGTGCT GA207336G2, Pnpla8 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTGGGAGAGGCACCGCTT GA207336G3, Pnpla8 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCCCTATTACGTAGGCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_026164
Synonyms	1200006O19Rik; AI467579; Ipla2(gamma)
Summary	Calcium-independent phospholipase A2, which catalyzes the hydrolysis of the sn-2 position of glycerophospholipids, PtdSer and to a lower extent PtdCho. Cleaves membrane phospholipids (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.