Mouse Pnpla8 activation kit by CRISPRa

CAT#: GA207336

Pnpla8 CRISPRa kit - CRISPR gene activation of mouse patatin-like phospholipase domain containing 8



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Pnpla8
Locus ID 67452
Kit Components

GA207336G1, Pnpla8 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTGTTGGAGCTGAGTGCT

GA207336G2, Pnpla8 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTGGGAGAGGCACCGCTT

GA207336G3, Pnpla8 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCCCTATTACGTAGGCTT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_026164
Synonyms 1200006O19Rik; AI467579; Ipla2(gamma)
Summary Calcium-independent phospholipase A2, which catalyzes the hydrolysis of the sn-2 position of glycerophospholipids, PtdSer and to a lower extent PtdCho. Cleaves membrane phospholipids (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...