Mouse Malat1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Malat1
Locus ID	72289
Kit Components	GA209185G1, Malat1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGATTTTTCTTGACGTCGTG GA209185G2, Malat1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCTTCCTTCACCAAGGTGG GA209185G3, Malat1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGGGACACGTCACTCCAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NR_002847
Summary	This gene produces a long non-coding RNA that is cleaved into a mature, functional transcript as well as a small cytoplasmic RNA (mascRNA). The mature transcript is stabilized by a 3' triple helical structure and is retained in the nucleus. This transcript functions in the regulation of gene expression and proliferation and may be upregulated in tumors. [provided by RefSeq, Nov 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.