Mouse Muc5b activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Muc5b
Locus ID	74180
Kit Components	GA209765G1, Muc5b gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCCCAAGAGCAAACACACG GA209765G2, Muc5b gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAGTAGACCGTGCCTTACA GA209765G3, Muc5b gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTGGACTTATGTAGCCAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_028801
Synonyms	2300002I04Rik; A130042M24; AV085033; MUC5; MUC9; mucin 5b

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.