Mouse Tirap activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Tirap
Locus ID	117149
Kit Components	GA212475G1, Tirap gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCAGTCTGGCCAAAAGTGC GA212475G2, Tirap gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAGCTTTGTGAAACGCCAA GA212475G3, Tirap gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAATCAAGAGTGGGCTAATA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001177845, NM_001177846, NM_001177847, NM_054096
Synonyms	AA407980; C130027E04Rik; Mal; Tlr4ap; Wyatt
Summary	Adapter involved in the TLR2 and TLR4 signaling pathways in the innate immune response. Acts via IRAK2 and TRAF-6, leading to the activation of NF-kappa-B, MAPK1, MAPK3 and JNK, and resulting in cytokine secretion and the inflammatory response (By similarity). Positively regulates the production of TNF-alpha and interleukin-6 (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.