Mouse C730036E19Rik activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	C730036E19Rik
Locus ID	402734
Kit Components	GA217368G1, C730036E19Rik gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGATAGCGAGTAGACTCTT GA217368G2, C730036E19Rik gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTAGTGTCAAGGGCTGAGC GA217368G3, C730036E19Rik gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTCAAGGAGTAAGAAGCCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NR_038011

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.