Mouse Sox1ot activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Sox1ot
Locus ID	434280
Kit Components	GA217630G1, Sox1ot gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCGGGACCCTTGGACCAT GA217630G2, Sox1ot gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGGCGCTTCATTATGTGG GA217630G3, Sox1ot gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGACTCGCAAGACAATTTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001013812, NR_027975

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.