STAT1 Human Gene Knockout Kit (CRISPR)

CAT#: KN201075LP

STAT1 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


STAT1 mouse monoclonal antibody, clone OTI4H9 (formerly 4H9)
    • 100 ul

CNY 1999.00
CNY 2700.00


STAT1 (Myc-DDK-tagged)-Human signal transducer and activator of transcription 1, 91kDa (STAT1), transcript variant alpha
    • 10 ug

CNY 8240.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol STAT1
UniProt ID P42224
Locus ID 6772
Kit Components

KN201075G1, STAT1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AAAGCTGGTGAACCTGCTCC

KN201075G2, STAT1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCAGCTTGACTCAAAATTCC

KN201075LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_007315, NM_139266
Synonyms CANDF7; IMD31A; IMD31B; IMD31C; ISGF-3; STAT91
Summary The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. The protein encoded by this gene can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. The protein plays an important role in immune responses to viral, fungal and mycobacterial pathogens. Mutations in this gene are associated with Immunodeficiency 31B, 31A, and 31C. [provided by RefSeq, Jun 2020]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...