DR5 (TNFRSF10B) Human Gene Knockout Kit (CRISPR)
CAT#: KN201588LP
TNFRSF10B - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
CNY 3710.00
CNY 1999.00
CNY 2700.00
CNY 3656.00
CNY 3990.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
Donor DNA | Luciferase-Puro |
Symbol | DR5 |
UniProt ID | O14763 |
Locus ID | 8795 |
Kit Components |
KN201588G1, DR5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AGAACGCCCCGGCCGCTTCG KN201588G2, DR5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCCGGAAAAGGCACGGCCC KN201588LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_003842, NM_147187, NR_027140 |
Synonyms | CD262; DR5; KILLER; KILLER/DR5; TRAIL-R2; TRAILR2; TRICK2; TRICK2A; TRICK2B; TRICKB; ZTNFR9 |
Summary | The protein encoded by this gene is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. Two transcript variants encoding different isoforms and one non-coding transcript have been found for this gene. [provided by RefSeq, Mar 2009] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN201588 | TNFRSF10B - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN201588BN | TNFRSF10B - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN201588RB | TNFRSF10B - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN401588 | TNFRSF10B - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA105841 | TNFRSF10B CRISPRa kit - CRISPR gene activation of human TNF receptor superfamily member 10b |
CNY 12255.00 |