SEPTIN7 Human Gene Knockout Kit (CRISPR)
CAT#: KN205163
SEPT7 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | SEPTIN7 |
Locus ID | 989 |
Kit Components |
KN205163G1, SEPTIN7 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCGAAGCTGAGACTCACCCA KN205163G2, SEPTIN7 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GAGCCGCTGACCCCAAGTCG KN205163-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001011553, NM_001242956, NM_001788, NM_001363715 |
Synonyms | CDC3; CDC10; NBLA02942; SEPT7A |
Summary | This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN205163BN | SEPT7 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN205163LP | SEPT7 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN205163RB | SEPT7 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN405163 | SEPT7 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA100704 | SEPTIN7 CRISPRa kit - CRISPR gene activation of human septin 7 |
CNY 12255.00 |
其它SEPTIN7产品