SEPTIN7 Human Gene Knockout Kit (CRISPR)

CAT#: KN205163

SEPT7 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Rabbit Polyclonal Anti-SEPT7 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


SEPT7 (Myc-DDK-tagged)-Human septin 7 (SEPT7), transcript variant 1
    • 10 ug

CNY 3656.00
CNY 3990.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol SEPTIN7
Locus ID 989
Kit Components

KN205163G1, SEPTIN7 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCGAAGCTGAGACTCACCCA

KN205163G2, SEPTIN7 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GAGCCGCTGACCCCAAGTCG

KN205163-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001011553, NM_001242956, NM_001788, NM_001363715
Synonyms CDC3; CDC10; NBLA02942; SEPT7A
Summary This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...