Eph receptor B4 (EPHB4) Human Gene Knockout Kit (CRISPR)
CAT#: KN208559LP
EPHB4 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
Donor DNA | Luciferase-Puro |
Symbol | Eph receptor B4 |
Locus ID | 2050 |
Kit Components |
KN208559G1, Eph receptor B4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCTTCGTTGGCCGCAGCTT KN208559G2, Eph receptor B4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGGTGAGTTTCCTTGCGGGG KN208559LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_004444 |
Synonyms | HTK; MYK1; TYRO11 |
Summary | Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN208559 | EPHB4 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN208559BN | EPHB4 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN208559RB | EPHB4 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN408559 | EPHB4 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA101429 | EPHB4 CRISPRa kit - CRISPR gene activation of human EPH receptor B4 |
CNY 12255.00 |
其它Eph receptor B4产品