BCMA (TNFRSF17) Human Gene Knockout Kit (CRISPR)

CAT#: KN208851BN

BCMA/TNFRSF17 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


BCMA/TNFRSF17 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 17 (BCMA/TNFRSF17)
    • 10 ug

CNY 3600.00
CNY 3705.00


TNFRSF17 mouse monoclonal antibody, clone OTI3H5
    • 100 ul

CNY 1999.00
CNY 3610.00

Specifications

Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA mBFP-Neo
Symbol BCMA
Locus ID 608
Kit Components

KN208851G1, BCMA gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAAGAACATCGAAGTTGACA

KN208851G2, BCMA gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TAACGCTGACATGTTAGAGG

KN208851BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001192
Synonyms BCM; BCMA; CD269; TNFRSF13A
Summary The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...