SOX9 Human Gene Knockout Kit (CRISPR)

CAT#: KN208944LP

SOX9 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


SOX9 mouse monoclonal antibody, clone OTI2H10 (formerly 2H10)
    • 100 ul

CNY 1999.00
CNY 2700.00


SOX9 (untagged)-Human SRY (sex determining region Y)-box 9 (SOX9)
    • 10 ug

CNY 3800.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol SOX9
Locus ID 6662
Kit Components

KN208944G1, SOX9 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCTCGGACACCGAGAACACG

KN208944G2, SOX9 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCTGAAGAAGGAGAGCGAGG

KN208944LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000346
Synonyms CMD1; CMPD1; SRA1; SRXX2; SRXY10
Summary The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...