PKR (EIF2AK2) Human Gene Knockout Kit (CRISPR)

CAT#: KN210792LP

EIF2AK2 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


EIF2AK2 mouse monoclonal antibody,clone OTI3F5
    • 100 ul

CNY 1999.00
CNY 2700.00


EIF2AK2 (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 2-alpha kinase 2 (EIF2AK2), transcript variant 1
    • 10 ug

CNY 6152.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol PKR
Locus ID 5610
Kit Components

KN210792G1, PKR gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TAATACATACCGTCAGAAGC

KN210792G2, PKR gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TATCAAGAACTGCCTAATTC

KN210792LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001135651, NM_001135652, NM_002759
Synonyms EIF2AK1; PKR; PPP1R83; PRKR
Summary The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...