PTPRS Human Gene Knockout Kit (CRISPR)

CAT#: KN211163LP

PTPRS - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


PTPRS rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


PTPRS (Myc-DDK-tagged)-Human protein tyrosine phosphatase, receptor type, S (PTPRS), transcript variant 4
    • 10 ug

CNY 10296.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol PTPRS
UniProt ID Q13332
Locus ID 5802
Kit Components

KN211163G1, PTPRS gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTTGTGGTCCTGCTCGTTGG

KN211163G2, PTPRS gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTGTCTGTGGTTGGTCCCAT

KN211163LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_002850, NM_130853, NM_130854, NM_130855
Synonyms PTPSIGMA; R-PTP-S; R-PTP-sigma
Summary The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...