Dystrophin (DMD) Human Gene Knockout Kit (CRISPR)

CAT#: KN211508BN

DMD - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Dystrophin Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp71ab
    • 10 ug

CNY 4632.00
CNY 5420.00

Specifications

Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA mBFP-Neo
Symbol Dystrophin
UniProt ID P11532
Locus ID 1756
Kit Components

KN211508G1, Dystrophin gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: ACAAGCAGCTGTTGGTAGCT

KN211508G2, Dystrophin gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TTCAAACATATGCTTTGTCA

KN211508BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Reference Data
RefSeq NM_000109, NM_004006, NM_004007, NM_004009, NM_004010, NM_004011, NM_004012, NM_004013, NM_004014, NM_004015, NM_004016, NM_004017, NM_004018, NM_004019, NM_004020, NM_004021, NM_004022, NM_004023
Synonyms BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272; MRX85
Summary This gene spans a genomic range of greater than 2 Mb and encodes a large protein containing an N-terminal actin-binding domain and multiple spectrin repeats. The encoded protein forms a component of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extracellular matrix. Deletions, duplications, and point mutations at this gene locus may cause Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or cardiomyopathy. Alternative promoter usage and alternative splicing result in numerous distinct transcript variants and protein isoforms for this gene. [provided by RefSeq, Dec 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...