Telomerase reverse transcriptase (TERT) Human Gene Knockout Kit (CRISPR)

CAT#: KN217436LP

TERT - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Mouse Monoclonal Antibody against Telomerase reverse transcriptase (2C4) - Embryonic Stem Cell Marker
    • 100 ul

CNY 6340.00


TERT (Myc-DDK-tagged)-Human telomerase reverse transcriptase (TERT), transcript variant 1
    • 10 ug

CNY 7880.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol Telomerase reverse transcriptase
UniProt ID O14746
Locus ID 7015
Kit Components

KN217436G1, Telomerase reverse transcriptase gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCCACGTTCGTGCGGCGCC

KN217436G2, Telomerase reverse transcriptase gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ACCAGCGCGCGGAAAGCCGC

KN217436LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001193376, NM_003219, NM_198253, NM_198254, NM_198255, NR_149162, NR_149163
Synonyms CMM9; DKCA2; DKCB4; EST2; hEST2; hTRT; PFBMFT1; TCS1; TP2; TRT
Summary Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

其它Telomerase reverse transcriptase产品

Customer Reviews 
Loading...