Leptin Receptor (LEPR) Human Gene Knockout Kit (CRISPR)
CAT#: KN218456LP
LEPR - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
Donor DNA | Luciferase-Puro |
Symbol | Leptin Receptor |
Locus ID | 3953 |
Kit Components |
KN218456G1, Leptin Receptor gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGTGTGGTTTTGTTACATTG KN218456G2, Leptin Receptor gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CAAAATCTCTACCATGTTTA KN218456LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001003679, NM_001003680, NM_001198687, NM_001198688, NM_001198689, NM_002303 |
Synonyms | CD295; LEP-R; LEPRD; OB-R; OBR |
Summary | The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN218456 | LEPR - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN218456BN | LEPR - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN218456RB | LEPR - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN418456 | LEPR - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA102678 | LEPR CRISPRa kit - CRISPR gene activation of human leptin receptor |
CNY 12255.00 |
其它Leptin Receptor产品