NF-kB p65 (RELA) Human Gene Knockout Kit (CRISPR)
CAT#: KN220780
RELA - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
CNY 3710.00
CNY 4104.00
CNY 4560.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | NF-kB p65 |
Locus ID | 5970 |
Kit Components |
KN220780G1, NF-kB p65 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCCGCGGGGTGGCATCGCCG KN220780G2, NF-kB p65 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGGGCCGCCGCGGCTGTGGC KN220780-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001145138, NM_001243984, NM_001243985, NM_021975 |
Synonyms | NFKB3; p65 |
Summary | NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN220780BN | RELA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN220780LP | RELA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN220780RB | RELA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN420780 | RELA - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA104066 | RELA CRISPRa kit - CRISPR gene activation of human RELA proto-oncogene, NF-kB subunit |
CNY 12255.00 |
其它NF-kB p65产品