Lats2 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN309148

Lats2 - mouse gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
4周

规格
    • 1 kit

Product images

经常一起买 (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


Lats2 (Myc-DDK-tagged) - Mouse large tumor suppressor 2 (Lats2), transcript variant B
    • 10 ug

CNY 2,400.00
CNY 3,705.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Lats2
Locus ID 50523
Kit Components

KN309148G1, Lats2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GATTGCAAGAGATTCGAGAG

KN309148G2, Lats2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CATCCAAGGCTTCCACCCAG

KN309148-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_015771, NM_153382
Synonyms 4932411G09Rik; AV277261; AW228608
Summary Negative regulator of YAP1 in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Phosphorylation of YAP1 by LATS2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration. Acts as a tumor suppressor which plays a critical role in centrosome duplication, maintenance of mitotic fidelity and genomic stability. Negatively regulates G1/S transition by down-regulating cyclin E/CDK2 kinase activity. Negative regulator of the androgen receptor. Phosphorylates SNAI1 in the nucleus leading to its nuclear retention and stabilization, which enhances its epithelial-mesenchymal transition and tumor cell invasion/migration activities. This tumor-promoting activity is independent of its effects upon YAP1 or WWTR1/TAZ (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...