Dll1 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN504620

Dll1 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated.




 KN2.0 knockout kit validation

  See Other Versions

CNY 8680.00

CNY 12260.00


货期*
2周

规格
    • 1 kit

Product images

推荐一起购买 (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Dll1 (Myc-DDK-tagged) - Mouse delta-like 1 (Drosophila) (Dll1)
    • 10 ug

CNY 7928.00

Specifications

Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol Dll1
UniProt ID Q61483
Locus ID 13388
Kit Components

KN504620G1, Dll1 gRNA vector 1 in pCas-Guide CRISPR vector

KN504620G2, Dll1 gRNA vector 2 in pCas-Guide CRISPR vector

KN504620D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT

Reference Data
RefSeq NM_007865
Synonyms Delta1
Summary Transmembrane ligand protein of NOTCH1, NOTCH2 and NOTCH3 receptors that binds the extracellular domain (ECD) of Notch receptor in a cis and trans fashion manner (PubMed:21985982, PubMed:10958687). Following transinteraction, ligand cells produce mechanical force that depends of a clathrin-mediated endocytosis, requiring ligand ubiquitination, EPN1 interaction, and actin polymerisation; these events promote Notch receptor extracellular domain (NECD) transendocytosis and triggers Notch signaling through induction of cleavage, hyperphosphorylation, and nuclear accumulation of the intracellular domain of Notch receptors (NICD) (PubMed:10958687, PubMed:18676613). Is required for embryonic development and maintenance of adult stem cells in many different tissues and immune systeme; the DLL1-induced Notch signaling is mediated through an intercellular communication that regulates cell lineage, cell specification, cell patterning and morphogenesis through effects on differentiation and proliferation (PubMed:17194759, PubMed:19562077, PubMed:18997111, PubMed:23695674, PubMed:16495313, PubMed:21238454, PubMed:22282195, PubMed:7671806, PubMed:17960184, PubMed:22529374, PubMed:19389377, PubMed:23699523, PubMed:19144989, PubMed:23688253, PubMed:23806616, PubMed:26114479, PubMed:22940113, PubMed:25220152, PubMed:20081190, PubMed:21572390, PubMed:22096075). Plays a role in brain development at different level, namely by regulating neuronal differentiation of neural precursor cells via cell-cell interaction, most likely through the lateral inhibitory system in an endogenous level dependent-manner (PubMed:7671806, PubMed:18997111). During neocortex development, Dll1-Notch signaling transmission is mediated by dynamic interactions between intermediate neurogenic progenitors and radial glia; the cell-cell interactions are mediated via dynamic and transient elongation processes, likely to reactivate/maintain Notch activity in neighboring progenitors, and coordinate progenitor cell division and differentiation across radial and zonal boundaries (PubMed:23699523). During cerebellar development, regulates Bergmann glial monolayer formation and its morphological maturation through a Notch signaling pathway (PubMed:23688253). At the retina and spinal cord level, regulates neurogenesis by preventing the premature differentiation of neural progenitors and also by maintaining progenitors in spinal cord through Notch signaling pathway (PubMed:19389377, PubMed:26114479). Also controls neurogenesis of the neural tube in a progenitor domain-specific fashion along the dorsoventral axis (PubMed:20081190). Maintains quiescence of neural stem cells and plays a role as a fate determinant that segregates asymmetrically to one daughter cell during neural stem cells mitosis, resulting in neuronal differentiation in Dll1-inheriting cell (PubMed:23695674). Plays a role in immune systeme development, namely the development of all T-cells and marginal zone (MZ) B cells (PubMed:15146182, PubMed:19217325). Blocks the differentiation of progenitor cells into the B-cell lineage while promoting the emergence of a population of cells with the characteristics of a T-cell/NK-cell precursor (By similarity). Upon MMP14 cleavage, negatively regulates Notch signaling in haematopoietic progenitor cells to specifically maintain normal B-cell development in bone marrow (PubMed:21572390). Also plays a role during muscle development. During early development, inhibits myoblasts differentiation from the medial dermomyotomal lip and later regulates progenitor cell differentiation (PubMed:17194759). Directly modulates cell adhesion and basal lamina formation in satellite cells through Notch signaling. Maintains myogenic progenitors pool by suppressing differentiation through down-regulation of MYOD1 and is required for satellite cell homing and PAX7 expression (PubMed:22940113). During craniofacial and trunk myogenesis suppresses differentiation of cranial mesoderm-derived and somite-derived muscle via MYOD1 regulation but in cranial mes
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...