GAPDH Human qPCR Primer Pair (NM_002046)

CAT＃: HP205798

qSTAR qPCR primer pairs against Homo sapiens gene GAPDH

Datasheet
SDS

CNY 1,140.00

货期*
5周
规格
    • 200 reactions
Cited in 66 publications.

Product images

经常一起买 (4)
NP100041
First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00

添加到购物车
NP100042
First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00

添加到购物车
TA802519
Mouse monoclonal anti-GAPDH antibody, clone OTI2D9 (formerly 2D9), loading control
    • 100 ul

CNY 600.00

添加到购物车

参与“2024逐梦开学季·科研添动力”活动,可提供10 µL试用规格

SC118869
GAPDH (untagged)-Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
    • 10 ug

CNY 2,950.00

添加到购物车

Specifications

Product Data
Gene ID 2597
Forward Sequence GTCTCCTCTGACTTCAACAGCG
Reverse Sequence ACCACCCTGTTGCTGTAGCCAA
Synonyms G3PD; GAPD; HEL-S-162eP
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (66)

The use of this Gene Expression has been cited in the following citations:
Extracellular vesicles carrying HIV-1 Nef induce long-term hyperreactivity of myeloid cells ,null, Cell reports ,PubMed ID 36417867 [GAPDH]
HIV integration in the human brain is linked to microglial activation and 3D genome remodeling. ,null, Molecular cell ,PubMed ID 36525955 [GAPDH]
C9orf16 represents the aberrant genetic programs and drives the progression of PDAC. ,null, BMC cancer ,PubMed ID 36307773 [GAPDH]
Lidocaine inhibited migration of NSCLCA549 cells via the CXCR4 regulation ,null, Cancer Biomarkers ,PubMed ID 34334384 [GAPDH]
A Multi-Organ-on-Chip Approach to Investigate How Oral Exposure to Metals Can Cause Systemic Toxicity Leading to Langerhans Cell Activation in Skin ,null, Frontiers in Toxicology ,PubMed ID 35295125 [GAPDH]
Kynurenine Monooxygenase Expression and Activity in Human Astrocytomas ,null, Cells ,PubMed ID 34440798 [GAPDH]
The Anti-Non-Small Cell Lung Cancer Cell Activity by a mTOR Kinase Inhibitor PQR620 ,Zha, JH;Xia, YC;Ye, CL;Hu, Z;Zhang, Q;Xiao, H;Yu, BT;Xu, WH;Xu, GQ;, Frontiers in oncology ,PubMed ID 34178653 [GAPDH]
Up-Regulation of the Long Noncoding RNA X-Inactive-Specific Transcript and the Imbalance Sex/Ratio of Pulmonary Arterial Hypertension ,Qin, S;Predescu, D;Carman, B;Patel, P;Chen, J;Kim, M;Lahm, T;Geraci, M;Predescu, S;, The American journal of pathology ,PubMed ID 33836164 [GAPDH]
MicroRNA-15a Carried by Mesenchymal Stem Cell-Derived Extracellular Vesicles Inhibits the Immune Evasion of Colorectal Cancer Cells by Regulating the KDM4B/HOXC4/PD-L1 Axis ,null, Frontiers in Cell and Developmental Biology ,PubMed ID 33732698 [GAPDH]
miR-708 Negatively Regulates TNFα/IL-1β Signaling by Suppressing NF-κB and Arachidonic Acid Pathways ,Monteleone, NJ;Lutz, CS;, Mediators of inflammation ,PubMed ID 33776573 [GAPDH]
Authentic and Ectopically Expressed MRGPRX2 Elicit Similar Mechanisms to Stimulate Degranulation of Mast Cells ,Lazki-Hagenbach, P;Ali, H;Sagi-Eisenberg, R;, Cells ,PubMed ID 33673037 [GAPDH]
A novel cause of DKC1 ‐related bone marrow failure: Partial deletion of the 3′ untranslated region ,Arthur, J;Pickett, H;Barbaro, P;Kilo, T;Vasireddy, R;Beilharz, T;Powell, D;Hackett, E;Bennetts, B;Curtin, J;Jones, K;Christodoulou, J;Reddel, R;Teo, J;Bryan, T;, eJHaem [GAPDH]
ATPIF1 maintains normal mitochondrial structure which is impaired by CCM3 deficiency in endothelial cells ,Wang, K;Chen, H;Zhou, Z;Zhang, H;Zhou, HJ;Min, W;, Cell & bioscience ,PubMed ID 33422124 [GAPDH]
Activation of NLRP3 by uropathogenic Escherichia coli is associated with IL-1β release and regulation of antimicrobial properties in human neutrophils ,Demirel, I;Persson, A;Brauner, A;Särndahl, E;Kruse, R;Persson, K;, Scientific reports ,PubMed ID 33318544 [GAPDH]
miR-708-5p Enhances Erlotinib/paclitaxel Efficacy and Overcomes Chemoresistance in Lung Cancer Cells ,Monteleone, N;Lutz, C;, Oncotarget. ,PubMed ID 33473256 [GAPDH]
Epigenetic Role of Histone Lysine Methyltransferase and Demethylase on the Expression of Transcription Factors Associated with the Epithelial-to-Mesenchymal Transition of Lung Adenocarcinoma Metastasis to the Brain ,Lee, YM;Kim, SH;Kim, MS;Kim, DC;Lee, EH;Lee, JS;Lee, SH;Kim, YZ;, Cancers ,PubMed ID 33291558 [GAPDH]
Vorinostat-loaded titanium oxide nanoparticles (anatase) induce G2/M cell cycle arrest in breast cancer cells via PALB2 upregulation ,Abdel-Ghany, S;Raslan, S;Tombuloglu, H;Shamseddin, A;Cevik, E;Said, O;Madyan, E;Senel, M;Bozkurt, A;Rehman, S;Sabit, H;, 3 Biotech ,PubMed ID 32904337 [GAPDH]
Long Noncoding RNA KCNQ1OT1 Confers Gliomas Resistance to Temozolomide and Enhances Cell Growth by Retrieving PIM1 From miR-761 ,Wang, W;Han, S;Gao, W;Feng, Y;Li, K;Wu, D;, Cell. Mol. Neurobiol. ,PubMed ID 32897512 [GAPDH]
FoxF1 protects rats from paraquat-evoked lung injury following HDAC2 inhibition via the microRNA-342/KLF5/IκB/NF-κB p65 axis ,Zheng, F;Liu, T;Zhu, J;Xie, Y;Wu, L;Lin, Z;, Exp. Cell Res. ,PubMed ID 32758486 [GAPDH]
Impaired AKT signaling and lung tumorigenesis by PIERCE1 ablation in KRAS-mutant non-small cell lung cancer ,Roh, JI;Lee, J;Sung, YH;Oh, J;Hyeon, DY;Kim, Y;Lee, S;Devkota, S;Kim, HJ;Park, B;Nam, T;Song, Y;Kim, Y;Hwang, D;Lee, HW;, Oncogene ,PubMed ID 32728173 [GAPDH]
Differential influence of Streptococcus mitis on host response to metals in reconstructed human skin and oral mucosa ,Shang, L;Deng, D;Roffel, S;Gibbs, S;, Contact Derm. ,PubMed ID 32677222 [GAPDH]
Titanium salts tested in reconstructed human skin with integrated MUTZ-3 derived Langerhans cells show an irritant rather than a sensitizing potential ,Rodrigues Neves, CT;Spiekstra, SW;de Graaf, NPJ;Rustemeyer, T;Feilzer, AJ;Kleverlaan, CJ;Gibbs, S;, Contact Derm. ,PubMed ID 32677096 [GAPDH]
Non-viral Gene Delivery of HIF-1α Promotes Angiogenesis in Human Adipose-Derived Stem Cells ,Est-Witte, S;Farris, A;Tzeng, S;Hutton, D;Gong, D;Calabresi, K;Grayson, W;Green, J;, Acta Biomaterialia ,PubMed ID 32623098 [GAPDH]
miR-708-5p targets oncogenic prostaglandin E2 production to suppress a pro-tumorigenic phenotype in lung cancer cells ,Monteleone, NJ;Lutz, CS;, Oncotarget ,PubMed ID 32655834 [GAPDH]
HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer ,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;, Cancer Res. ,PubMed ID 32605998 [GAPDH]
Galectin-1 Overexpression Activates the FAK/PI3K/AKT/mTOR Pathway and Is Correlated with Upper Urinary Urothelial Carcinoma Progression and Survival ,Su, YL;Luo, HL;Huang, CC;Liu, TT;Huang, EY;Sung, MT;Lin, JJ;Chiang, PH;Chen, YT;Kang, CH;Cheng, YT;, Cells ,PubMed ID 32225123 [GAPDH]
Rapid generation of purified human RPE from pluripotent stem cells using 2D cultures and lipoprotein uptake-based sorting ,Michelet, F;Balasankar, A;Teo, N;Stanton, LW;Singhal, S;, Stem Cell Res Ther ,PubMed ID 32014053 [GAPDH]
Long noncoding RNA UCA1 promotes autophagy by targeting miR-96-5p in acute myeloid leukemia ,Li, JJ;Chen, XF;Wang, M;Zhang, PP;Zhang, F;Zhang, JJ;, Clin. Exp. Pharmacol. Physiol. ,PubMed ID 31953866 [GAPDH]
Ninjurin2 overexpression promotes glioma cell growth ,Zhou, LN;Li, P;Cai, S;Li, G;Liu, F;, Aging (Albany NY) 2019 ,PubMed ID 31794427 [GAPDH]
CysLT1 receptor antagonists Pranlukast and Zafirlukast inhibit LRRC8-mediated volume regulated anion channels independently of the receptor ,Figueroa, EE;Kramer, M;Strange, K;Denton, JS;, Am. J. Physiol., Cell Physiol. ,PubMed ID 31390227 [GAPDH]
microRNA-7 inhibition protects human osteoblasts from dexamethasone via activation of epidermal growth factor receptor signaling ,Fan, JB;Liu, W;Zhu, XH;Cui, SY;Cui, ZM;Zhao, JN;, Mol. Cell. Biochem. ,PubMed ID 31313024 [GAPDH]
MicroRNA Let-7f-1-3p attenuates smoke-induced apoptosis in bronchial and alveolar epithelial cells in vitro by targeting FOXO1 ,Han, Z;Zhu, Y;Cui, Z;Guo, P;Wei, A;Meng, Q;, Eur. J. Pharmacol. ,PubMed ID 31301310 [GAPDH]
Long non-coding RNA LINC00641 suppresses non-small-cell lung cancer by sponging miR-424-5p to upregulate PLSCR4 ,Li, Y;Zhao, L;Zhao, P;Liu, Z;, Cancer Biomark ,PubMed ID 31322545 [GAPDH]
Endothelial senescence is induced by phosphorylation and nuclear export of telomeric repeat binding factor 2-interacting protein ,Kotla, S;Vu, HT;Ko, KA;Wang, Y;Imanishi, M;Heo, KS;Fujii, Y;Thomas, TN;Gi, YJ;Mazhar, H;Paez-Mayorga, J;Shin, JH;Tao, Y;Giancursio, CJ;Medina, JL;Taunton, J;Lusis, AJ;Cooke, JP;Fujiwara, K;Le, NT;Abe, JI;, JCI Insight ,PubMed ID 31045573 [GAPDH]
Methylation of SPARCL1 Is Associated with Oncologic Outcome of Advanced Upper Urinary Tract Urothelial Carcinoma ,Luo, HL;Chiang, PH;Huang, CC;Su, YL;Sung, MT;Tsai, EM;Lin, CS;Chiang, PH;, Int J Mol Sci ,PubMed ID 30987093 [GAPDH]
Upregulation of CBP by PLY can cause permeability of blood-brain barrier to increase meningitis ,Chen, JQ;Li, NN;Wang, BW;Liu, XF;Liu, JL;Chang, Q;, J. Biochem. Mol. Toxicol. ,PubMed ID 30980515 [GAPDH]
Identification of myeloid-derived suppressor cells that have an immunosuppressive function in NF2 patients ,Wang, Y;Li, P;Wang, B;Wang, S;Liu, P;, J. Cancer Res. Clin. Oncol. ,PubMed ID 30603902 [GAPDH]
Overexpression of CCN1 in Het1A cells attenuates bile-induced esophageal metaplasia through suppressing non-canonical NFκB activation ,Dang, T;Meng, X;Modak, C;Wu, J;Chang, Z;Che, N;Narvaez, R;Chai, J;, Cytokine ,PubMed ID 30685604 [GAPDH]
EGF ligand fused to truncated Pseudomonas aeruginosa exotoxin A specifically targets and inhibits EGFR‑positive cancer cells ,Hashimi, SM;Grant, B;Alqurashi, N;Alowaidi, F;Wei, MQ;, Oncol. Rep. ,PubMed ID 30226622 [GAPDH]
ETV1 activates a rapid conduction transcriptional program in rodent and human cardiomyocytes ,Shekhar, A;Lin, X;Lin, B;Liu, FY;Zhang, J;Khodadadi-Jamayran, A;Tsirigos, A;Bu, L;Fishman, GI;Park, DS;, Sci Rep ,PubMed ID 29967479 [GAPDH]
Methods to Study the Role of Progranulin in the Tumor Microenvironment ,Elkabets, M;Brook, S;, Methods Mol. Biol. ,PubMed ID 29956276 [GAPDH]
Assessing stemness and proliferation properties of the newly established colon cancer 'stem' cell line, CSC480 and novel approaches to identify dormant cancer cells ,Alowaidi, F;Hashimi, SM;Alqurashi, N;Alhulais, R;Ivanovski, S;Bellette, B;Meedenyia, A;Lam, A;Wood, S;, Oncol. Rep. ,PubMed ID 29693155 [GAPDH]
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics ,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;, Cell Rep ,PubMed ID 28834758 [GAPDH]
Dengue virus compartmentalization during antibody-enhanced infection ,Ong, EZ;Zhang, SL;Tan, HC;Gan, ES;Chan, KR;Ooi, EE;, Sci Rep ,PubMed ID 28084461 [GAPDH]
Cyclophosphamide promotes breast cancer cell migration through CXCR4 and matrix metalloproteinases ,Hung, CM;Hsu, YC;Chen, TY;Chang, CC;Lee, MJ;, Cell Biol. Int ,PubMed ID 28035725 [GAPDH]
Increased epidermal thickness and abnormal epidermal differentiation in keloid scars ,Limandjaja, GC;van den Broek, LJ;Waaijman, T;van Veen, HA;Everts, V;Monstrey, S;Scheper, RJ;Niessen, FB;Gibbs, S;, Br. J. Dermatol. ,PubMed ID 27377288 [GAPDH]
Serum availability affects expression of common house-keeping genes in colon adenocarcinoma cell lines: implications for quantitative real-time PCR studies ,Krzystek-Korpacka, M;Hotowy, K;Czapinska, E;Podkowik, M;Bania, J;Gamian, A;Bednarz-Misa, I;, Cytotechnology ,PubMed ID 27339468 [GAPDH]
PKC epsilon Promotes Synaptogenesis through Membrane Accumulation of the Postsynaptic Density Protein PSD-95 ,Sen, A;Hongpaisan, J;Wang, D;Nelson, TJ;Alkon, DL;, J. Biol. Chem. ,PubMed ID 27330081 [GAPDH]
Host glycosylation pathways and the unfolded protein response contribute to the infection by Francisella ,Barel, M;Harduin-Lepers, A;Portier, L;Slomianny, MC;Charbit, A;, Cell. Microbiol. ,PubMed ID 27185209 [GAPDH]
Sulfotransferase-1A1-dependent bioactivation of aristolochic acid I and N-hydroxyaristolactam I in human cells ,Hashimoto, K;Zaitseva, IN;Bonala, R;Attaluri, S;Ozga, K;Iden, CR;Johnson, F;Moriya, M;Grollman, AP;Sidorenko, VS;, Carcinogenesis ,PubMed ID 27207664 [GAPDH]
miR-146a Attenuates Inflammatory Pathways Mediated by TLR4/NF-κB and TNFα to Protect Primary Human Retinal Microvascular Endothelial Cells Grown in High Glucose ,null, Mediators of Inflammation ,PubMed ID 26997759 [GAPDH]
MicroRNA-153 is a prognostic marker and inhibits cell migration and invasion by targeting SNAI1 in human pancreatic ductal adenocarcinoma ,Bai, Z;Sun, J;Wang, X;Wang, H;Pei, H;Zhang, Z;, Oncol. Rep. ,PubMed ID 26062664 [GAPDH]
Anti-proliferative effects of ?-tocotrienol are associated with suppression of c-Myc expression in mammary tumour cells ,Parajuli, P;Tiwari, RV;Sylvester, PW;, Cell Prolif. ,PubMed ID 26096843 [GAPDH]
In vivo delivery of transcription factors with multifunctional oligonucleotides ,Lee, K;Rafi, M;Wang, X;Aran, K;Feng, X;Lo Sterzo, C;Tang, R;Lingampalli, N;Kim, HJ;Murthy, N;, Nat Mater ,PubMed ID 25915034 [GAPDH]
A Mechanistic Investigation of Fc? R Signaling During Antibody-enhanced Dengue Infection ,ONG ZIYING, E;, Thesis [GAPDH]
MicroRNA-520g induces epithelial-mesenchymal transition and promotes metastasis of hepatocellular carcinoma by targeting SMAD7 ,Kan, H;Guo, W;Huang, Y;Liu, D;, FEBS Lett. ,PubMed ID 25436421 [GAPDH]
Expression Stability of Common Housekeeping Genes Is Differently Affected by Bowel Inflammation and Cancer: Implications for Finding Suitable Normalizers for Inflammatory Bowel Disease Studies ,Krzystek-Korpacka, M;Diakowska, D;Bania, J;Gamian, A;, Inflamm. Bowel Dis. ,PubMed ID 24859298 [GAPDH]
A cellular model of amyloid precursor protein processing and amyloid-Beta peptide production ,Macias, MP;Gonzales, AM;Siniard, AL;Walker, AW;Corneveaux, JJ;Huentelman, MJ;Sabbagh, MN;Decourt, B;, J. Neurosci. Methods Dec 2013. ,PubMed ID 24333289 [GAPDH]
Differential gene expression in cholesteatoma by DNA chip analysis. ,null, The Laryngoscope ,PubMed ID 23670528 [GAPDH]
NAC1, A POZ/BTB protein interacts with Parkin and may contribute to Parkinson's disease ,Korutla, L;Furlong, HA;Mackler, SA;, Neuroscience ,PubMed ID 24231739 [GAPDH]
Human papillomavirus type 16 E7 oncoprotein inhibits the anaphase promoting complex/cyclosome activity by dysregulating EMI1 expression in mitosis ,Yu, Y;Munger, K;, Virology. 2013 Nov;446(1-2):251-9. doi: 10.1016/j.virol.2013.08.013 ,PubMed ID 24074588 [GAPDH]
Delivery of small interfering RNAs in human cervical cancer cells by polyethylenimine-functionalized carbon nanotubes ,null, Nanoscale Research Letters ,PubMed ID 23742156 [GAPDH]
The Human Papillomavirus Type 8 E6 Protein Interferes with NOTCH Activation during Keratinocyte Differentiation ,Jordan M. Meyers, Jennifer M. Spangle, and Karl Munger, J. Virol., Apr 2013; 87: 4762 - 4767. ,PubMed ID 23365452 [GAPDH]
Sulfated Polysaccharide, Curdlan Sulfate, Efficiently Prevents Entry/Fusion and Restricts Antibody-Dependent Enhancement of Dengue Virus Infection In Vitro: A Possible Candidate for Clinical Application ,null, PLoS Neglected Tropical Diseases ,PubMed ID 23658845 [GAPDH]
Nitric Oxide–Producing Myeloid-Derived Suppressor Cells Inhibit Vascular E-Selectin Expression in Human Squamous Cell Carcinomas ,Ahmed E Gehad, Michael K Lichtman, Chrysalyne D Schmults, Jessica E Teague, Adam W Calarese, Ying Jiang, Rei Watanabe & Rachael A Clark, Journal of Investigative Dermatology doi:10.1038/jid.2012.190 [GAPDH]
Dentin Sialophosphoprotein (DSPP) Gene-Silencing Inhibits Key Tumorigenic Activities in Human Oral Cancer Cell Line, OSC2 ,null, PLoS ONE ,PubMed ID 21103065 [GAPDH]

Documents

FAQs

其它GAPDH产品

Expression Plasmids
Lentiviral Particles
CRISPR
RNAi
Proteins
Antibodies
相关产品 (1)

NP100041

First Strand cDNA Synthesis Kit (11801-025)

    • 25 reactions

CNY 1,330.00

Previous
Next
Customer Reviews