ABL2 Human qPCR Primer Pair (NM_007314)

CAT#: HP230726

qSTAR qPCR primer pairs against Homo sapiens gene ABL2



CNY 1140.00


货期*
5周

规格
    • 200 reactions

Product images

推荐一起购买 (13)
Anti-ABL2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


ABL2 (Myc-DDK-tagged)-Human v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) (ABL2), transcript variant c
    • 10 ug

CNY 8128.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2710.00


ABL2 (Myc-DDK-tagged)-Human v-abl Abelson murine leukemia viral oncogene homolog 2 (ABL2), transcript variant h
    • 10 ug

CNY 7368.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1330.00


ABL2 (Myc-DDK-tagged)-Human v-abl Abelson murine leukemia viral oncogene homolog 2 (ABL2), transcript variant c
    • 10 ug

CNY 8936.00


ABL2 (Myc-DDK-tagged)-Human v-abl Abelson murine leukemia viral oncogene homolog 2 (ABL2), transcript variant e
    • 10 ug

CNY 4040.00
CNY 4560.00


ABL2 (Myc-DDK-tagged)-Human v-abl Abelson murine leukemia viral oncogene homolog 2 (ABL2), transcript variant g
    • 10 ug

CNY 10740.00


ABL2 (Myc-DDK-tagged)-Human v-abl Abelson murine leukemia viral oncogene homolog 2 (ABL2), transcript variant i
    • 10 ug

CNY 7264.00


ABL2 (Myc-DDK-tagged)-Human v-abl Abelson murine leukemia viral oncogene homolog 2 (ABL2), transcript variant b
    • 10 ug

CNY 8232.00


ABL2 (Myc-DDK-tagged)-Human v-abl Abelson murine leukemia viral oncogene homolog 2 (ABL2), transcript variant f
    • 10 ug

CNY 8088.00


ABL2 (Myc-DDK-tagged)-Human v-abl Abelson murine leukemia viral oncogene homolog 2 (ABL2), transcript variant d
    • 10 ug

CNY 7408.00

Specifications

Product Data
Gene ID 27
Forward Sequence CGGACACTGAAGAAACAGGTGG
Reverse Sequence GTCTCTTTGCTTTCGAGGCAGTG
Synonyms ABLL; ARG
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...