Vegfa Mouse qPCR Primer Pair (NM_001025250)
CNY 1140.00
| Cited in 3 publications. | 
Product images
 
                    
                CNY 2710.00
CNY 5488.00
Specifications
| Product Data | |
| Gene ID | 22339 | 
| Forward Sequence | CTGCTGTAACGATGAAGCCCTG | 
| Reverse Sequence | GCTGTAGGAAGCTCATCTCTCC | 
| Synonyms | V; Veg; Vegf; VEGF12; VEGF16; VEGF18; Vpf | 
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. | 
| Storage & Stability | Store at -20°C. | 
Citations (3)
| The use of this Gene Expression has been cited in the following citations: | 
|---|
| Inhibition of MLKL Attenuates Necroptotic Cell Death in a Murine Cell Model of Ischaemia Injury
                                                ,Baidya, R;Gautheron, J;Crawford, DHG;Wang, H;Bridle, KR;,
                                                Journal of clinical medicine
                                                ,PubMed ID 33435617
                                                [VEGFA] | 
| 4D Microvascular Analysis Reveals that Regenerative Angiogenesis in Ischemic Muscle Produces a Flawed Microcirculation
                                                ,Arpino, JM;Nong, Z;Li, F;Yin, H;Ghonaim, NW;Milkovich, S;Balint, B;O'Neil, C;Fraser, GM;Goldman, D;Ellis, CG;Pickering, JG;,
                                                Circ. Res
                                                ,PubMed ID 28174322
                                                [Vegfa] | 
| Copper chelation enhances anti-tumor efficacy and systemic delivery of oncolytic HSV
                                                ,null,
                                                Clinical cancer research : an official journal of the American Association for Cancer Research
                                                ,PubMed ID 22753591
                                                [Vegfa] | 
Documents
| FAQs | 
Resources
| 基因表达相关资源 | 

 
        