Hspb6 (NM_001012401) Mouse Untagged Clone
CAT#: MC213180
Hspb6 (untagged) - Mouse heat shock protein, alpha-crystallin-related, B6 (Hspb6), (10ug)
CNY 3990.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | AA387366; Gm479; Hsp20 | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >MC213180 representing NM_001012401 
Red=Cloning site Blue=ORF Orange=Stop codon CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGC GCCC ATGGAGATCCCCGTGCCTGTGCAGCCTTCTTGGCTGCGCCGTGCTTCAGCTCCTTTACCAGGTTTCTCTG CTCCGGGACGCCTCTTTGACCAGCGTTTCGGCGAAGGGCTGCTTGAGGCAGAGCTGGCTTCACTGTGCCC TGCTGCGATCGCCCCCTACTATCTGCGCGCCCCCAGTGTGGCGTTACCCACAGCCCAGGTGTCCACGGAC TCTGGGTATTTTTCCGTGCTGCTGGATGTGAAGCACTTCTTGCCAGAGGAAATCTCTGTCAAGGTGGTTG ACGACCATGTGGAGGTCCATGCTCGGCACGAGGAGCGCCCGGATGAACACGGATTCATTGCTCGAGAGTT CCACCGCCGATACCGCCTGCCTCCTGGTGTGGACCCTGCTGCTGTGACCTCAGCACTGTCTCCTGAGGGT GTCCTGTCCATCCAGGCCACACCAGCGTCGGCCCAGGCCCAACTTCCGTCACCACCTGCTGCCAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA  | 
        
| Restriction Sites | AscI-MluI | 
| ACCN | NM_001012401 | 
| Insert Size | 489 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_001012401.2, NP_001012401.1 | 
| RefSeq Size | 1383 bp | 
| RefSeq ORF | 489 bp | 
| Locus ID | 243912 | 
| UniProt ID | Q5EBG6 | 
| Gene Summary | Small heat shock protein which functions as a molecular chaperone probably maintaining denatured proteins in a folding-competent state. Seems to have versatile functions in various biological processes. Plays a role in regulating muscle function such as smooth muscle vasorelaxation and cardiac myocyte contractility. May regulate myocardial angiogenesis implicating KDR. Overexpression mediates cardioprotection and angiogenesis after induced damage. Stabilizes monomeric YWHAZ thereby supporting YWHAZ chaperone-like activity.[UniProtKB/Swiss-Prot Function] | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG222204 | Hspb6 (tGFP-tagged) - Mouse heat shock protein alpha-crystallin-related B6 (Hspb6), (10ug) | 
                                                     CNY 2850.00  | 
                                            |
| MR222204 | Hspb6 (Myc-DDK-tagged) - Mouse heat shock protein, alpha-crystallin-related, B6 (Hspb6) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 1200.00  | 
                                            |
| MR222204L3 | Lenti ORF clone of Hspb6 (Myc-DDK-tagged) - Mouse heat shock protein, alpha-crystallin-related, B6 (Hspb6) | 
                                                     CNY 4750.00  | 
                                            |
| MR222204L4 | Lenti ORF clone of Hspb6 (mGFP-tagged) - Mouse heat shock protein, alpha-crystallin-related, B6 (Hspb6) | 
                                                     CNY 4750.00  | 
                                            
