PGBD2 (NM_001017434) Human Untagged Clone

CAT#: SC302053

PGBD2 (untagged)-Human piggyBac transposable element derived 2 (PGBD2), transcript variant 2



  "NM_001017434" in other vectors (4)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-PGBD2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302053 representing NM_001017434.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACTGCAATTTCCAGAAGCATGCACCCTTGGAAGAGTTCTACAGCTTTGGCGAGTCTATGTGTGAG
TACTTTGGGCACCGGGGGTCCAAGCAGCTGCACAGGGGGAAGCCTGTGCGACTTGGCTACAAGATTTGG
TGTGGGACAACCAGCAGAGGCTACTTGGTGTGGTTTGAGCCCTCACAGGGCACACTGTTTACCAAGCCA
GACAGGAGCTTGGATCTAGGAGGCAGTATGGTAATAAAATTTGTGGATGCGCTTCAGGAGCGTGGTTTT
CTGCCATATCACATATTTTTTGACAAGGTTTTCACAAGTGTTAAACTGATGTCCATTTTGAGGAAAAAG
GGGGTGAAAGCCACAGGAACTGTTCGTGAGTACAGGACTGAGCGATGTCCCCTAAAAGACCCCAAAGAA
CTGAAAAAAATGAAGAGGGGTTCATTTGATTACAAAGTCGATGAGAGTGAGGAGATCATCGTGTGCCGC
TGGCACGATAGCAGCGTGGTCAACATTTGCTCCAATGCTGTGGGCATAGAGCCAGTGAGGCTGACCAGT
CGTCACTCTGGAGCAGCTAAAACGCGGACTCAGGTCCACCAGCCATCACTGGTGAAGCTGTATCAGGAG
AAGGTGGGTGGCGTTGGTAGGATGGATCAGAATATTGCCAAGTACAAGGTGAAGATCCGAGGCATGAAG
TGGTACTCAAGCTTTATTGGCTATGTCATTGATGCTGCCCTCAACAATGCATGGCAGCTGCATAGAATC
TGCTGCCAAGATGCCCAGGTGGACCTCCTTGCCTTCCGGAGATACATTGCCTGTGTGTATCTGGAGAGC
AATGCTGACACAACATCTCAAGGGAGGCGAAGCAGGCGGTTGGAGACTGAGAGCCGCTTCGATATGATT
GGGCACTGGATTATCCATCAGGACAAGAGGACCCGGTGTGCCCTCTGCCACTCACAGACCAACACCCGG
TGTGAGAAGTGCCAGAAGGGTGTCCATGCCAAATGCTTCAGGGAGTACCACATCCGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001017434
Insert Size 1026 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001017434.1
RefSeq Size 2035 bp
RefSeq ORF 1026 bp
Locus ID 267002
UniProt ID Q6P3X8
MW 39.6 kDa
Gene Summary The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. The exact function of this gene is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...