PSIP1 (NM_021144) Human Untagged Clone
CAT#: SC312998
PSIP1 (untagged)-Human PC4 and SFRS1 interacting protein 1 (PSIP1), transcript variant 1
CNY 5488.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DFS70; LEDGF; p52; p75; PAIP; PSIP2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_021144 edited
CCCCGCGCCGCCGCATCTCCTCGCCGCCTCCCGGGCTTCGGACCCCCGGTCTCGCCCCCG AAACATGACTCGCGATTTCAAACCTGGAGACCTCATCTTCGCCAAGATGAAAGGTTATCC CCATTGGCCAGCTCGAGTAGACGAAGTTCCTGATGGAGCTGTAAAGCCACCCACAAACAA ACTACCCATTTTCTTTTTTGGAACTCATGAGACTGCTTTTTTAGGACCAAAGGATATATT TCCTTACTCAGAAAATAAGGAAAAGTATGGCAAACCAAATAAAAGAAAAGGTTTTAATGA AGGTTTATGGGAGATAGATAACAATCCAAAAGTGAAATTTTCAAGTCAACAGGCAGCAAC TAAACAATCAAATGCATCATCTGATGTTGAAGTTGAAGAAAAGGAAACTAGTGTTTCAAA GGAAGATACCGACCATGAAGAAAAAGCCAGCAATGAGGATGTGACTAAAGCAGTTGACAT AACTACTCCAAAAGCTGCCAGAAGGGGGAGAAAGAGAAAGGCAGAAAAACAAGTAGAAAC TGAGGAGGCAGGAGTAGTGACAACAGCAACAGCATCTGTTAATCTAAAAGTGAGTCCTAA AAGAGGACGACCTGCAGCTACAGAAGTCAAGATTCCAAAACCAAGAGGCAGACCCAAAAT GGTAAAACAGCCCTGTCCTTCAGAGAGTGACATCATTACTGAAGAGGACAAAAGTAAGAA AAAGGGGCAAGAGGAAAAACAACCTAAAAAGCAGCCTAAGAAGGATGAAGAGGGCCAGAA GGAAGAAGATAAGCCAAGAAAAGAGCCGGATAAAAAAGAGGGGAAGAAAGAAGTTGAATC AAAAAGGAAAAATTTAGCTAAAACAGGGGTTACTTCAACCTCCGATTCTGAAGAAGAAGG AGATGATCAAGAAGGTGAAAAGAAGAGAAAAGGTGGGAGGAACTTTCAGACTGCTCACAG AAGGAATATGCTGAAAGGCCAACATGAGAAAGAAGCAGCAGATCGAAAACGCAAGCAAGA GGAACAAATGGAAACTGAGCACCAAACAACATGTAATCTACAGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_021144 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone has been fully sequenced and its ORF matches with NM_021144.2. One SNP was found in ORF. This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021144.2, NP_066967.2 |
| RefSeq Size | 1677 bp |
| RefSeq ORF | 1002 bp |
| Locus ID | 11168 |
| UniProt ID | O75475 |
| Domains | PWWP |
| Protein Families | Stem cell - Pluripotency, Transcription Factors |
| Gene Summary | Transcriptional coactivator involved in neuroepithelial stem cell differentiation and neurogenesis. Involved in particular in lens epithelial cell gene regulation and stress responses. May play an important role in lens epithelial to fiber cell terminal differentiation. May play a protective role during stress-induced apoptosis. Isoform 2 is a more general and stronger transcriptional coactivator. Isoform 2 may also act as an adapter to coordinate pre-mRNA splicing. Cellular cofactor for lentiviral integration.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the shortest transcript and encodes isoform 1. |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Mutant p53 Disrupts Role of ShcA Protein in Balancing Smad Protein-dependent and -independent Signaling Activity of Transforming Growth Factor-ß (TGF-ß)
,Shu Lin, Lan Yu, Junhua Yang, Zhao Liu, Bijal Karia, Alexander J. R. Bishop, James Jackson, Guillermina Lozano, John A. Copland, Xiaoxin Mu, Beicheng Sun, and Lu-Zhe Sun,
J. Biol. Chem., Dec 2011; 286: 44023 - 44034.
[PSIP1]
|
|
Screening for Antiviral Inhibitors of the HIV Integrase—LEDGF/p75 Interaction Using the AlphaScreenTM Luminescent Proximity Assay
,Yan Hou, Debra E. Mcguinness, Andrew J. Prongay, Boris Feld, Paul Ingravallo, Robert A. Ogert, Charles A. Lunn, and John A. Howe,
J Biomol Screen, Jun 2008; 13: 406 - 414.
[PSIP1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212915 | PSIP1 (Myc-DDK-tagged)-Human PC4 and SFRS1 interacting protein 1 (PSIP1), transcript variant 1 |
CNY 3600.00 |
|
| RC212915L1 | Lenti-ORF clone of PSIP1 (Myc-DDK-tagged)-Human PC4 and SFRS1 interacting protein 1 (PSIP1), transcript variant 1 |
CNY 6000.00 |
|
| RC212915L2 | Lenti-ORF clone of PSIP1 (mGFP-tagged)-Human PC4 and SFRS1 interacting protein 1 (PSIP1), transcript variant 1 |
CNY 5890.00 |
|
| RC212915L3 | Lenti-ORF clone of PSIP1 (Myc-DDK-tagged)-Human PC4 and SFRS1 interacting protein 1 (PSIP1), transcript variant 1 |
CNY 5890.00 |
|
| RC212915L4 | Lenti-ORF clone of PSIP1 (mGFP-tagged)-Human PC4 and SFRS1 interacting protein 1 (PSIP1), transcript variant 1 |
CNY 5890.00 |
|
| RG212915 | PSIP1 (tGFP-tagged) - Human PC4 and SFRS1 interacting protein 1 (PSIP1), transcript variant 1 |
CNY 5200.00 |
