PSIP1 (NM_021144) Human Untagged Clone

CAT#: SC312998

PSIP1 (untagged)-Human PC4 and SFRS1 interacting protein 1 (PSIP1), transcript variant 1



  "NM_021144" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Cited in 2 publications.

Product images

推荐一起购买 (3)
Rabbit Polyclonal Anti-PSIP1 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFS70; LEDGF; p52; p75; PAIP; PSIP2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_021144 edited
CCCCGCGCCGCCGCATCTCCTCGCCGCCTCCCGGGCTTCGGACCCCCGGTCTCGCCCCCG
AAACATGACTCGCGATTTCAAACCTGGAGACCTCATCTTCGCCAAGATGAAAGGTTATCC
CCATTGGCCAGCTCGAGTAGACGAAGTTCCTGATGGAGCTGTAAAGCCACCCACAAACAA
ACTACCCATTTTCTTTTTTGGAACTCATGAGACTGCTTTTTTAGGACCAAAGGATATATT
TCCTTACTCAGAAAATAAGGAAAAGTATGGCAAACCAAATAAAAGAAAAGGTTTTAATGA
AGGTTTATGGGAGATAGATAACAATCCAAAAGTGAAATTTTCAAGTCAACAGGCAGCAAC
TAAACAATCAAATGCATCATCTGATGTTGAAGTTGAAGAAAAGGAAACTAGTGTTTCAAA
GGAAGATACCGACCATGAAGAAAAAGCCAGCAATGAGGATGTGACTAAAGCAGTTGACAT
AACTACTCCAAAAGCTGCCAGAAGGGGGAGAAAGAGAAAGGCAGAAAAACAAGTAGAAAC
TGAGGAGGCAGGAGTAGTGACAACAGCAACAGCATCTGTTAATCTAAAAGTGAGTCCTAA
AAGAGGACGACCTGCAGCTACAGAAGTCAAGATTCCAAAACCAAGAGGCAGACCCAAAAT
GGTAAAACAGCCCTGTCCTTCAGAGAGTGACATCATTACTGAAGAGGACAAAAGTAAGAA
AAAGGGGCAAGAGGAAAAACAACCTAAAAAGCAGCCTAAGAAGGATGAAGAGGGCCAGAA
GGAAGAAGATAAGCCAAGAAAAGAGCCGGATAAAAAAGAGGGGAAGAAAGAAGTTGAATC
AAAAAGGAAAAATTTAGCTAAAACAGGGGTTACTTCAACCTCCGATTCTGAAGAAGAAGG
AGATGATCAAGAAGGTGAAAAGAAGAGAAAAGGTGGGAGGAACTTTCAGACTGCTCACAG
AAGGAATATGCTGAAAGGCCAACATGAGAAAGAAGCAGCAGATCGAAAACGCAAGCAAGA
GGAACAAATGGAAACTGAGCACCAAACAACATGTAATCTACAGTAA
Restriction Sites Please inquire     
ACCN NM_021144
Insert Size 1100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone has been fully sequenced and its ORF matches with NM_021144.2. One SNP was found in ORF. This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021144.2, NP_066967.2
RefSeq Size 1677 bp
RefSeq ORF 1002 bp
Locus ID 11168
UniProt ID O75475
Domains PWWP
Protein Families Stem cell - Pluripotency, Transcription Factors
Gene Summary Transcriptional coactivator involved in neuroepithelial stem cell differentiation and neurogenesis. Involved in particular in lens epithelial cell gene regulation and stress responses. May play an important role in lens epithelial to fiber cell terminal differentiation. May play a protective role during stress-induced apoptosis. Isoform 2 is a more general and stronger transcriptional coactivator. Isoform 2 may also act as an adapter to coordinate pre-mRNA splicing. Cellular cofactor for lentiviral integration.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the shortest transcript and encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Other Versions

Customer Reviews 
Loading...