TMEM97 (NM_014573) Human Untagged Clone

CAT#: SC317273

TMEM97 (untagged)-Human transmembrane protein 97 (TMEM97)



  "NM_014573" in other vectors (7)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal TMEM97 Antibody
    • 100 ul

CNY 5381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MAC30
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_014573 edited
ATGGGGGCTCCGGCAACCAGGCGCTGCGTGGAGTGGCTGCTGGGCCTCTACTTCCTCAGC
CACATCCCCATCACCCTGTTCATGGACCTGCAGGCGGTGCTGCCGCGCGAGCTCTACCCA
GTCGAGTTTAGAAACCTGCTGAAGTGGTATGCTAAGGAGTTCAAAGACCCACTGCTACAG
GAGCCCCCAGCCTGGTTTAAGTCCTTTCTGTTTTGCGAGCTTGTGTTTCAGCTGCCTTTC
TTTCCCATTGCAACGTATGCCTTCCTCAAAGGAAGCTGCAAGTGGATTCGAACTCCTGCA
ATCATCTACTCTGTTCACACCATGACAACCTTAATTCCGATACTCTCCACATTTCTGTTT
GAGGATTTCTCCAAAGCCAGTGGTTTCAAGGGACAAAGACCTGAGACTTTGCATGAACGG
TTAACCCTTGTGTCTGTCTATGCCCCCTACTTACTCATCCCATTCATACTTTTAATTTTC
ATGTTGCGGAGCCCCTACTACAAGTATGAAGAGAAAAGAAAAAAAAAATGA
Restriction Sites NotI-NotI     
ACCN NM_014573
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequnced and found to be a perfect match to NM_014573.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_014573.2, NP_055388.2
RefSeq Size 2585 bp
RefSeq ORF 531 bp
Locus ID 27346
UniProt ID Q5BJF2
Protein Families Transmembrane
Gene Summary TMEM97 is a conserved integral membrane protein that plays a role in controlling cellular cholesterol levels (Bartz et al., 2009 [PubMed 19583955]).[supplied by OMIM, Aug 2009]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...