NPM2 (NM_001286680) Human Untagged Clone

CAT#: SC334513

NPM2 (untagged) - Human nucleophosmin/nucleoplasmin 2 (NPM2), transcript variant 2



  "NM_001286680" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-NPM2 Antibody - N-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001286680, the custom clone sequence may differ by one or more nucleotides


ATGAATCTCAGTAGCGCCAGTAGCACGGAGGAAAAGGCAGTGACGACCGTGCTCTGGGGCTGCGAGCTCA
GTCAGGAGAGGCGGACTTGGACCTTCAGACCCCAGCTGGAGGGGAAGCAGAGCTGCAGGCTGTTGCTTCA
TACGATTTGCTTGGGGGAGAAAGCCAAAGAGGAGATGCATCGCGTGGAGATCCTGCCCCCAGCAAACCAG
GAGGACAAGAAGATGCAGCCGGTCACCATTGCCTCACTCCAGGCCTCAGTCCTCCCCATGGTCTCCATGG
TAGGAGTGCAGCTTTCTCCCCCAGTTACTTTCCAGCTCCGGGCTGGCTCAGGACCCGTGTTCCTCAGTGG
CCAGGAACGTTATGAAGCATCAGACCTAACCTGGGAGGAGGAGGAGGAAGAAGAAGGGGAGGAGGAGGAA
GAGGAAGAGGAAGATGATGAGGATGAGGATGCAGATATATCTCTGGAGGAGCAAAGCCCTGTCAAACAAG
TCAAAAGGCTGGTGCCCCAGAAGCAGGCGAGCGTGGCTAAGAAAAAAAAGCTGGAAAAAGAAGAAGAGGA
AATAAGAGCCAGCGTTAGAGACAAGAGCCCTGTGAAAAAGGCCAAAGCCACAGCCAGAGCCAAGAAGCCA
GGATTCAAGAAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001286680
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286680.1, NP_001273609.1
RefSeq Size 1532 bp
RefSeq ORF 645 bp
Locus ID 10361
UniProt ID Q86SE8
Gene Summary Core histones chaperone involved in chromatin reprogramming, specially during fertilization and early embryonic development. Probably involved in sperm DNA decondensation during fertilization.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...