Human CD70 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD70
Locus ID	970
Kit Components	GA100691G1, CD70 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAACTCTGAGGCTCACCCG GA100691G2, CD70 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGTCTGAAGATCCTAAAG GA100691G3, CD70 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGACTTGAGCAATTGGCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001252, NM_001330332
Synonyms	CD27L; CD27LG; TNFSF7
Summary	The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. It induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. This cytokine is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin sythesis. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.