Human GBA activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	GBA
Locus ID	2629
Kit Components	GA101750G1, GBA gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGAACGAACAAGTGTCGC GA101750G2, GBA gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCCTTCCTCAAGTCTCAT GA101750G3, GBA gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGACGGTCACTCATGCAG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000157, NM_001005741, NM_001005742, NM_001005749, NM_001005750, NM_001171811, NM_001171812
Synonyms	GBA1; GCB; GLUC
Summary	This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.