GBA Human Gene Knockout Kit (CRISPR)
CAT#: KN201614BN
GBA - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12260.00
Cited in 1 publication. |
CNY 3710.00
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | GBA |
UniProt ID | P04062 |
Locus ID | 2629 |
Kit Components |
KN201614G1, GBA gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CAGCATTGTCACAGTGCTTC KN201614G2, GBA gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTTTTCAAGTCCTTCCAGAG KN201614BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_000157, NM_001005741, NM_001005742, NM_001005749, NM_001005750, NM_001171811, NM_001171812 |
Synonyms | GBA1; GCB; GLUC |
Summary | This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010] |
Citations (1)
The use of this Gene Expression has been cited in the following citations: |
---|
GBA Regulates EMT/MET and Chemoresistance in Squamous Cell Carcinoma Cells by Modulating the Cellular Glycosphingolipid Profile
,null,
Cells
,PubMed ID 37508550
[GBA]
|
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN201614 | GBA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN201614LP | GBA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN201614RB | GBA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN401614 | GBA - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
|
GA101750 | GBA CRISPRa kit - CRISPR gene activation of human glucosylceramidase beta |
CNY 12255.00 |