Human Vimentin (VIM) activation kit by CRISPRa
CAT#: GA105122
VIM CRISPRa kit - CRISPR gene activation of human vimentin
CNY 12255.00
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | VIM |
Locus ID | 7431 |
Kit Components | GA105122G1, Vimentin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCTTTAATGACTTCCACCA GA105122G2, Vimentin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGATCAGTGGTTTTTACCC GA105122G3, Vimentin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGATCACGATTGCACCGGGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_003380 |
Synonyms | CTRCT30; HEL113 |
Summary | This gene encodes a type III intermediate filament protein. Intermediate filaments, along with microtubules and actin microfilaments, make up the cytoskeleton. The encoded protein is responsible for maintaining cell shape and integrity of the cytoplasm, and stabilizing cytoskeletal interactions. This protein is involved in neuritogenesis and cholesterol transport and functions as an organizer of a number of other critical proteins involved in cell attachment, migration, and signaling. Bacterial and viral pathogens have been shown to attach to this protein on the host cell surface. Mutations in this gene are associated with congenital cataracts in human patients. [provided by RefSeq, Aug 2017] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN401546 | VIM - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |