Human WWP1 activation kit by CRISPRa
CAT#: GA107598
WWP1 CRISPRa kit - CRISPR gene activation of human WW domain containing E3 ubiquitin protein ligase 1
CNY 12255.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | WWP1 |
| Locus ID | 11059 |
| Kit Components | GA107598G1, WWP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGTCTTCGGGTATGACCAA GA107598G2, WWP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACCTTAAGAAGTCCTGCTC GA107598G3, WWP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGGACAGCCAATAGTAGGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_007013 |
| Synonyms | AIP5; hSDRP1; Tiul1 |
| Summary | WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN406243 | WWP1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
