Human WWP1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	WWP1
Locus ID	11059
Kit Components	GA107598G1, WWP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGTCTTCGGGTATGACCAA GA107598G2, WWP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACCTTAAGAAGTCCTGCTC GA107598G3, WWP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGGACAGCCAATAGTAGGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_007013
Synonyms	AIP5; hSDRP1; Tiul1
Summary	WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.