Human PNLIPRP3 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PNLIPRP3
Locus ID	119548
Kit Components	GA114690G1, PNLIPRP3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCGGAACATCTTATAGC GA114690G2, PNLIPRP3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAAGTGCCTAATCCTGGTT GA114690G3, PNLIPRP3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTGCCTTACATCTTATGAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001011709
Synonyms	OTTHUMP00000020563; pancreatic lipase-related protein 3

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.