Human BORIS (CTCFL) activation kit by CRISPRa
CAT#: GA115390
CTCFL CRISPRa kit - CRISPR gene activation of human CCCTC-binding factor like
CNY 12255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | CTCFL |
Locus ID | 140690 |
Kit Components | GA115390G1, BORIS gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCCCTCCCCTAGGTGTCAC GA115390G2, BORIS gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGAGGGGGGTGGTGGGTAA GA115390G3, BORIS gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGGGTAGGAGGGCCAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_001269040, NM_001269041, NM_001269042, NM_001269043, NM_001269044, NM_001269045, NM_001269046, NM_001269047, NM_001269048, NM_001269049, NM_001269050, NM_001269051, NM_001269052, NM_001269054, NM_001269055, NM_080618, NR_072975 |
Synonyms | BORIS; CT27; CTCF-T; dJ579F20.2; HMGB1L1 |
Summary | CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN216042 | CTCFL - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN216042BN | CTCFL - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN216042LP | CTCFL - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN216042RB | CTCFL - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
KN416042 | CTCFL - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |