CD36 Human qPCR Primer Pair (NM_000072)
CNY 1140.00
| Cited in 4 publications. |
Product images
CNY 1999.00
CNY 2700.00
CNY 3656.00
CNY 3990.00
CNY 2710.00
CNY 3656.00
CNY 3990.00
CNY 3990.00
CNY 3656.00
CNY 3990.00
CNY 3990.00
CNY 3656.00
CNY 3990.00
CNY 3990.00
CNY 3656.00
CNY 3990.00
Specifications
| Product Data | |
| Gene ID | 948 |
| Forward Sequence | CAGGTCAACCTATTGGTCAAGCC |
| Reverse Sequence | GCCTTCTCATCACCAATGGTCC |
| Synonyms | BDPLT10; CHDS7; FAT; GP3B; GP4; GPIV; PASIV; SCARB3 |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (4)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
Rapid generation of purified human RPE from pluripotent stem cells using 2D cultures and lipoprotein uptake-based sorting
,Michelet, F;Balasankar, A;Teo, N;Stanton, LW;Singhal, S;,
Stem Cell Res Ther
,PubMed ID 32014053
[CD36]
|
|
Inflammatory Cytokine-Mediated Regulation of Thrombospondin-1 and CD36 in Conjunctival Cells
,Soriano-Romaní, L;Contreras-Ruiz, L;García-Posadas, L;López-García, A;Masli, S;Diebold, Y;,
J Ocul Pharmacol Ther
,PubMed ID 26154920
[CD36]
|
|
Thrombospondin-1 induces differential response in human corneal and conjunctival epithelial cells lines under in vitro inflammatory and apoptotic conditions
,Soriano-Romaní, L;García-Posadas, L;López-García, A;Paraoan, L;Diebold, Y;,
Exp. Eye Res.
,PubMed ID 25753839
[CD36]
|
|
Selenoprotein K is required for palmitoylation of CD36 in macrophages: implications in foam cell formation and atherogenesis
,null,
Journal of Leukocyte Biology
,PubMed ID 23444136
[CD36]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |

