SGLT1 (SLC5A1) Human qPCR Primer Pair (NM_000343)
CNY 1140.00
Cited in 4 publications. |
Product images

CNY 2710.00
CNY 4944.00
CNY 5800.00
Specifications
Product Data | |
Gene ID | 6523 |
Forward Sequence | CGCCTATCCAACCTTAGTGGTG |
Reverse Sequence | CGCTGTTGAAGATGGAGGTCAG |
Synonyms | D22S675; NAGT; SGLT1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
Pharmacological evaluation of HM41322, a novel SGLT1/2 dual inhibitor, in vitro and in vivo
,null,
The Korean Journal of Physiology & Pharmacology : Official Journal of the Korean Physiological Society and the Korean Society of Pharmacology
,PubMed ID 30627010
[SLC5A1]
|
Real‐time imaging of sodium glucose transporter (SGLT1) trafficking and activity in single cells. Real time imaging of sodium glucose transporter (SGLT1) trafficking and activity in single cells
,null,
Physiological Reports
,PubMed ID 28193781
[SLC5A1]
|
Targeting Type 2 Diabetes with C-Glucosyl Dihydrochalcones as Selective Sodium Glucose Co-Transporter 2 (SGLT2) Inhibitors: Synthesis and Biological Evaluation.
,null,
Journal of medicinal chemistry
,PubMed ID 28098449
[SLC5A1]
|
SHR3824, a novel selective inhibitor of renal sodium glucose cotransporter 2, exhibits antidiabetic efficacy in rodent models
,null,
Acta Pharmacologica Sinica
,PubMed ID 24786232
[SLC5A1]
|
Documents
FAQs |
Resources
基因表达相关资源 |