IL6 Human qPCR Primer Pair (NM_000600)
CNY 1,140.00
Cited in 7 publications. |
Product images
CNY 3,600.00
CNY 3,705.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 3569 |
Forward Sequence | AGACAGCCACTCACCTCTTCAG |
Reverse Sequence | TTCTGCCAGTGCCTCTTTGCTG |
Synonyms | BSF-2; BSF2; CDF; HGF; HSF; IFN-beta-2; IFNB2; IL-6 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (7)
The use of this Gene Expression has been cited in the following citations: |
---|
Reactivated endogenous retroviruses promote protein aggregate spreading
,null,
Nature Communications
,PubMed ID 37596282
[IL6]
|
The HMGB1-AGER-STING1 pathway mediates the sterile inflammatory response to alkaliptosis
,Fang, X;Dai, E;Bai, L;Liu, J;Kang, R;Zhao, Y;Han, L;Tang, D;,
Biochemical and biophysical research communications
,PubMed ID 33992959
[IL6]
|
Upregulation of CBP by PLY can cause permeability of blood-brain barrier to increase meningitis
,Chen, JQ;Li, NN;Wang, BW;Liu, XF;Liu, JL;Chang, Q;,
J. Biochem. Mol. Toxicol.
,PubMed ID 30980515
[IL6]
|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[IL6]
|
Probing the response of human osteoblasts following exposure to sympathetic neuron-like PC-12 cells in a 3D co-culture model
,Erndt-Marino, J;Hahn, MS;,
J Biomed Mater Res A
,PubMed ID 27860234
[IL6]
|
A 3D chondrocyte-macrophage co-culture system to probe inflammation in experimental osteoarthritis
,Samavedi, S;Diaz-Rodriguez, P;Erndt-Marino, JD;Hahn, M;,
Tissue Eng Part A
,PubMed ID 27736317
[IL6]
|
MicroRNA-138 Inhibits Periodontal Progenitor Differentiation under Inflammatory Conditions
,Zhou, X;Luan, X;Chen, Z;Francis, M;Gopinathan, G;Li, W;Lu, X;Li, S;Wu, C;Diekwisch, TG;,
J. Dent. Res.
,PubMed ID 26518300
[IL6]
|
Documents
FAQs |
Resources
基因表达相关资源 |