TGF beta 1 (TGFB1) Human qPCR Primer Pair (NM_000660)
CNY 1140.00
| Cited in 5 publications. |
Product images
CNY 2710.00
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Gene ID | 7040 |
| Forward Sequence | TACCTGAACCCGTGTTGCTCTC |
| Reverse Sequence | GTTGCTGAGGTATCGCCAGGAA |
| Synonyms | CED; DPD1; IBDIMDE; LAP; TGF-beta1; TGFB; TGFbeta |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (5)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
Identification of myeloid-derived suppressor cells that have an immunosuppressive function in NF2 patients
,Wang, Y;Li, P;Wang, B;Wang, S;Liu, P;,
J. Cancer Res. Clin. Oncol.
,PubMed ID 30603902
[TGFB1]
|
|
Endothelial cells enhance adipose mesenchymal stromal cell-mediated matrix contraction via ALK receptors and reduced follistatin: Potential role of endothelial cells in skin fibrosis
,Monsuur, HN;van den Broek, LJ;Koolwijk, P;Niessen, FB;Gibbs, S;,
J. Cell. Physiol.
,PubMed ID 29345319
[TGFB1]
|
|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[TGFB1]
|
|
Development of 3D Alginate Encapsulation for Better ChondrogenicDifferentiation Potential than the 2D Pellet System
,Debnath, T;Shalini, U;Kona, LK;JVS, VS;Kamaraju, SR;,
J Stem Cell Res Ther
[TGFB1]
|
|
Hypoxia down-regulates expression of secretory leukocyte protease inhibitor in bronchial epithelial cells via TGF-ß1
,Påhlman, LI;Jögi, A;Gram, M;Mori, M;,
BMC Pulmonary Medicine
[TGFB1]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |

