N Cadherin (CDH2) Human qPCR Primer Pair (NM_001792)
CNY 1140.00
| Cited in 3 publications. |
Product images
CNY 2710.00
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Gene ID | 1000 |
| Forward Sequence | CCTCCAGAGTTTACTGCCATGAC |
| Reverse Sequence | GTAGGATCTCCGCCACTGATTC |
| Synonyms | ACOGS; ARVD14; CD325; CDHN; CDw325; NCAD |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (3)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
MicroRNA-15a Carried by Mesenchymal Stem Cell-Derived Extracellular Vesicles Inhibits the Immune Evasion of Colorectal Cancer Cells by Regulating the KDM4B/HOXC4/PD-L1 Axis
,null,
Frontiers in Cell and Developmental Biology
,PubMed ID 33732698
[CDH2]
|
|
Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
Cell death & disease
,PubMed ID 33608512
[CDH2]
|
|
Loss of GFAT1 promotes epithelial-to-mesenchymal transition and predicts unfavorable prognosis in gastric cancer
,Duan, F;Jia, D;Zhao, J;Wu, W;Min, L;Song, S;Wu, H;Wang, L;Wang, H;Ruan, Y;Gu, J;,
Oncotarget
,PubMed ID 27509259
[CDH2]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |

