VEGF Receptor 2 (KDR) Human qPCR Primer Pair (NM_002253)
CNY 1140.00
| Cited in 3 publications. | 
Product images
 
                    
                CNY 13920.00
CNY 2710.00
                                                
                                                
                                                
                                                    CNY 1999.00 
                                                    
                                                    CNY 2700.00
                                                
                                            
Specifications
| Product Data | |
| Gene ID | 3791 | 
| Forward Sequence | GGAACCTCACTATCCGCAGAGT | 
| Reverse Sequence | CCAAGTTCGTCTTTTCCTGGGC | 
| Synonyms | CD309; FLK1; VEGFR; VEGFR2 | 
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. | 
| Storage & Stability | Store at -20°C. | 
Citations (3)
| The use of this Gene Expression has been cited in the following citations: | 
|---|
| Low-flow intussusception and metastable VEGFR2 signaling launch angiogenesis in ischemic muscle
                                                ,null,
                                                Science Advances
                                                ,PubMed ID 34826235
                                                [KDR] | 
| Evaluation of late outgrowth endothelial progenitor cell and umbilical vein endothelial cell responses to thromboresistant collagen-mimetic hydrogels
                                                ,Munoz-Pinto, DJ;Erndt-Marino, JD;Becerra-Bayona, SM;Guiza-Arguello, VR;Samavedi, S;Malmut, S;Reichert, WM;Russell, B;H??k, M;Hahn, MS;,
                                                J Biomed Mater Res A
                                                ,PubMed ID 28218444
                                                [KDR] | 
| Gene Signatures of 1,25-Dihydroxyvitamin D3 Exposure in Normal and Transformed Mammary Cells
                                                ,Simmons, KM;Beaudin, SG;Narvaez, CJ;Welsh, J;,
                                                J. Cell. Biochem.
                                                ,PubMed ID 25736056
                                                [KDR] | 
Documents
| FAQs | 
Resources
| 基因表达相关资源 | 

 
        