ABCG2 Human qPCR Primer Pair (NM_004827)
CNY 1140.00
Cited in 4 publications. |
Product images

CNY 2710.00
CNY 7328.00
Specifications
Product Data | |
Gene ID | 9429 |
Forward Sequence | GTTCTCAGCAGCTCTTCGGCTT |
Reverse Sequence | TCCTCCAGACACACCACGGATA |
Synonyms | ABC15; ABCP; BCRP; BCRP1; BMDP; CD338; CDw338; EST157481; GOUT1; MRX; MXR; MXR-1; MXR1; UAQTL1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
Assessing stemness and proliferation properties of the newly established colon cancer 'stem' cell line, CSC480 and novel approaches to identify dormant cancer cells
,Alowaidi, F;Hashimi, SM;Alqurashi, N;Alhulais, R;Ivanovski, S;Bellette, B;Meedenyia, A;Lam, A;Wood, S;,
Oncol. Rep.
,PubMed ID 29693155
[ABCG2]
|
Enhancement of Cancer-Specific Protoporphyrin IX Fluorescence by Targeting Oncogenic Ras/MEK Pathway
,null,
Theranostics
,PubMed ID 29721068
[ABCG2]
|
Induction of Stemlike Cells with Fibrogenic Properties by Carbon Nanotubes and Its Role in Fibrogenesis
,null,
Nano Letters
,PubMed ID 24873662
[ABCG2]
|
Influence of HIV antiretrovirals on methadone N-demethylation and transport.
,null,
Biochemical pharmacology
,PubMed ID 25801005
[ABCG2]
|
Documents
FAQs |
Resources
基因表达相关资源 |