MMP9 Human qPCR Primer Pair (NM_004994)
CNY 1140.00
| Cited in 6 publications. |
Product images
CNY 7768.00
CNY 2710.00
Specifications
| Product Data | |
| Gene ID | 4318 |
| Forward Sequence | GCCACTACTGTGCCTTTGAGTC |
| Reverse Sequence | CCCTCAGAGAATCGCCAGTACT |
| Synonyms | CLG4B; GELB; MANDP2; MMP-9 |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (6)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
Effect of LDHA Inhibition on TNF-α-Induced Cell Migration in Esophageal Cancers
,null,
International Journal of Molecular Sciences
,PubMed ID 36555705
[MMP9]
|
|
Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
Cell death & disease
,PubMed ID 33608512
[MMP9]
|
|
The Effect of Neddylation Inhibition on Inflammation-Induced MMP9 Gene Expression in Esophageal Squamous Cell Carcinoma
,null,
International Journal of Molecular Sciences
,PubMed ID 33572115
[MMP9]
|
|
HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer
,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;,
Cancer Res.
,PubMed ID 32605998
[MMP9]
|
|
Influence of shear stress on phenotype and MMP production of smooth muscle cells in a co-culture model
,Han, X;Sakamoto, N;Tomita, N;Meng, H;Sato, M;Ohta, M;,
J Biorheol
[MMP9]
|
|
Cyclophosphamide promotes breast cancer cell migration through CXCR4 and matrix metalloproteinases
,Hung, CM;Hsu, YC;Chen, TY;Chang, CC;Lee, MJ;,
Cell Biol. Int
,PubMed ID 28035725
[MMP9]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |

