PKC epsilon (PRKCE) Human qPCR Primer Pair (NM_005400)
CNY 1140.00
| Cited in 4 publications. |
Product images
CNY 2710.00
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Gene ID | 5581 |
| Forward Sequence | AGCCTCGTTCACGGTTCTATGC |
| Reverse Sequence | GCAGTGACCTTCTGCATCCAGA |
| Synonyms | nPKC-epsilon; PKCE |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (4)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
PKCε Activation Restores Loss of PKCε, Manganese Superoxide Dismutase, Vascular Endothelial Growth Factor, and Microvessels in Aged and Alzheimer’s Disease Hippocampus
,null,
Frontiers in Aging Neuroscience
,PubMed ID 35299945
[PRKCE]
|
|
PKC epsilon Promotes Synaptogenesis through Membrane Accumulation of the Postsynaptic Density Protein PSD-95
,Sen, A;Hongpaisan, J;Wang, D;Nelson, TJ;Alkon, DL;,
J. Biol. Chem.
,PubMed ID 27330081
[PRKCE]
|
|
PKCe Deficits in Alzheimer's Disease Brains and Skin Fibroblasts
,Khan, TK;Sen, A;Hongpaisan, J;Lim, CS;Nelson, TJ;Alkon, DL;,
J. Alzheimers Dis.
,PubMed ID 25125477
[PRKCE]
|
|
Phorbol-12-myristate 13-acetate acting through protein kinase Cε induces translocator protein (18-kDa) Tspo gene expression †
,null,
,PubMed ID 18975922
[PRKCE]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |
